8. What is the structure of ribosomes, and how are they assembled? (8 points)

4. Please describe how starch is synthesized in plants (4 points) and how this process is regulated by photosynthesis (4 points).

5. How is the organic sulfide assimilated from sulfate? (8 points)

6. Please compare the carbamoyl-phosphate I and II according to their substrate; intracellular locations; involved pathways; regulators. (8 points)

7. How are eukaryotic transcripts processed and delivered to the ribosomes fortranslation? (8 points)

9. Please design a set of oligonucleotide primers (16-mers) of the following shortDNA sequence for PCR amplification (5' -＞ 3'). (8 points)TGTGGGAGCTGTGATGATGTTTGTAGGCTTCCTGGGGTGCTATGGGGCCATCCAGGAGGTGGCTGCAGGCATCTGGGGCTTCGTAAACAAAGACCAGATCGCCAAGGA

10. A 12-kb DNA fragment was digested with restriction enzymes HindIII and Pstlunder the following conditions:(1) Digestion with HindIII yielded fragments of 3 kb, 4 kb, and 5 kb.(2) Digestion with PstI yielded fragments of 2 kb, 5 kb, and 5 kb.(3) Concomitant digestion with both HindIII and PstI yielded fragments of 1 kb, 2kb, 2 kb, 3 kb, and 4 kb.Using this data, please construct a possible restriction map of the original 12-kb fragment. (8 points)

(1) bacteria can convert ammonia to nitrites:________；

(2) smallest bacteria capable of self-reproduction:______；

(3) oral thrush:______；

(4) Synechococcus and______ are two bacterial species account for ~1/3 of global CO2 fixation；