5. How is the organic sulfide assimilated from sulfate? (8 points)

1. Why do polysaccharides have greater structural diversity compared to polypeptides? (8 points)

2. Which two amino acids are completely positively charged at physiological pH? (8 points)

3. Please describe or illustrate the structure (2 points) of ATP synthase and how this machinery links to the chemiosmotic hypothesis (6 points).

4. Please describe how starch is synthesized in plants (4 points) and how this process is regulated by photosynthesis (4 points).

6. Please compare the carbamoyl-phosphate I and II according to their substrate; intracellular locations; involved pathways; regulators. (8 points)

7. How are eukaryotic transcripts processed and delivered to the ribosomes fortranslation? (8 points)

8. What is the structure of ribosomes, and how are they assembled? (8 points)

9. Please design a set of oligonucleotide primers (16-mers) of the following shortDNA sequence for PCR amplification (5' -＞ 3'). (8 points)TGTGGGAGCTGTGATGATGTTTGTAGGCTTCCTGGGGTGCTATGGGGCCATCCAGGAGGTGGCTGCAGGCATCTGGGGCTTCGTAAACAAAGACCAGATCGCCAAGGA

10. A 12-kb DNA fragment was digested with restriction enzymes HindIII and Pstlunder the following conditions:(1) Digestion with HindIII yielded fragments of 3 kb, 4 kb, and 5 kb.(2) Digestion with PstI yielded fragments of 2 kb, 5 kb, and 5 kb.(3) Concomitant digestion with both HindIII and PstI yielded fragments of 1 kb, 2kb, 2 kb, 3 kb, and 4 kb.Using this data, please construct a possible restriction map of the original 12-kb fragment. (8 points)

(1) bacteria can convert ammonia to nitrites:________；