4. Please describe how starch is synthesized in plants (4 points) and how this process is regulated by photosynthesis (4 points).

6.The drug Taxol, extracted from the bark of yew trees, has an opposite effect to the drug chochicine, an alkaloid form autumn crocus. Taxol binds tightly to microtubules and stabilizes them when added to cells, it causes much of the free tubulin to assemble into microtubules. In contrast, chochicine prevents microtubule formation. Taxol is just as harmful to dividing cells as chochicine, and both are used as anticancer drugs. Based on your knowledge of microtubule dynamics, suggest why both drugs are toxic to dividing cells despite their opposite action. (5%)

1. Why do polysaccharides have greater structural diversity compared to polypeptides? (8 points)

2. Which two amino acids are completely positively charged at physiological pH? (8 points)

3. Please describe or illustrate the structure (2 points) of ATP synthase and how this machinery links to the chemiosmotic hypothesis (6 points).

5. How is the organic sulfide assimilated from sulfate? (8 points)

6. Please compare the carbamoyl-phosphate I and II according to their substrate; intracellular locations; involved pathways; regulators. (8 points)

7. How are eukaryotic transcripts processed and delivered to the ribosomes fortranslation? (8 points)

8. What is the structure of ribosomes, and how are they assembled? (8 points)

9. Please design a set of oligonucleotide primers (16-mers) of the following shortDNA sequence for PCR amplification (5' -＞ 3'). (8 points)TGTGGGAGCTGTGATGATGTTTGTAGGCTTCCTGGGGTGCTATGGGGCCATCCAGGAGGTGGCTGCAGGCATCTGGGGCTTCGTAAACAAAGACCAGATCGCCAAGGA

10. A 12-kb DNA fragment was digested with restriction enzymes HindIII and Pstlunder the following conditions:(1) Digestion with HindIII yielded fragments of 3 kb, 4 kb, and 5 kb.(2) Digestion with PstI yielded fragments of 2 kb, 5 kb, and 5 kb.(3) Concomitant digestion with both HindIII and PstI yielded fragments of 1 kb, 2kb, 2 kb, 3 kb, and 4 kb.Using this data, please construct a possible restriction map of the original 12-kb fragment. (8 points)